View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_low_29 (Length: 369)
Name: NF16006_low_29
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 19 - 201
Target Start/End: Original strand, 48358946 - 48359129
Alignment:
| Q |
19 |
tcatgacattgaggcgcattaataattgcacacgtttacccgtagtgatcactttgcgcggttcaaattacct-agtcataagtaattgcacacgtttac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48358946 |
tcatgacattgaggcgcattaataattgcacacgtttacccgtagtgatcactttgcgcggttcaaattaccttagtcataagtaattgcacacgtttac |
48359045 |
T |
 |
| Q |
118 |
ttgcgtcaatgaaaacaaaacttgattttaaaatgtccacacataggcattcacattcacaggcatataaattgataaatcttt |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48359046 |
ttgcgtcaatgaaaacaaaagttgattttaaaatgtccacacataggcattcacattcacaggcatataaattgataaatcttt |
48359129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 196 - 364
Target Start/End: Original strand, 48361298 - 48361467
Alignment:
| Q |
196 |
atctttaccatactgttttaatacgtagtacagtaaaatatcagttgagtta-ggtgaaattttaaacaatgctttcataacaagtttataaccattttc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48361298 |
atctttaccatactgttttaatacgtagtacagtataatatcagttgagttaaggtgaaattttaaacaatgctttcataacaagtttataaccattttc |
48361397 |
T |
 |
| Q |
295 |
aggccctactttgccctcctttgtggtttttcttaacattatccttttctttttacggattcatctcact |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48361398 |
aggccctactttgccctcctttgtggtttttcttaacattatccttttctttttacggattcatcacact |
48361467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University