View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_low_30 (Length: 367)
Name: NF16006_low_30
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 89; Significance: 8e-43; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 134 - 274
Target Start/End: Complemental strand, 493856 - 493717
Alignment:
| Q |
134 |
ctgcagcaaatagaaaacattatttccaacattgtttccattgaaaaaaacattgnnnnnnnnnnnnngtacaaaacattgtttgtttttaaaaattata |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
493856 |
ctgcagcaaatagaaaacattatttccaacattgtttccattgaaaaaaacattgtttttttttttg-gtacaaaacattgtttgtttttaaaaattata |
493758 |
T |
|
| Q |
234 |
aatatcatataattctatgtactcgttatgtatttattact |
274 |
Q |
| |
|
|||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
493757 |
aataccaaataattctatgtactcgttatgtatttattact |
493717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 292 - 356
Target Start/End: Complemental strand, 493431 - 493367
Alignment:
| Q |
292 |
tatttattacttttaaaaccaaagatcacaaaaattacgtgtcataatcttttcattctagtatt |
356 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
493431 |
tatttattacttttaaaaccgaagatcacaaaaattacgtgtcataatcttttcattctagtatt |
493367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University