View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_low_46 (Length: 314)
Name: NF16006_low_46
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_low_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 10 - 299
Target Start/End: Original strand, 2669805 - 2670094
Alignment:
| Q |
10 |
agataattctatatggtcatcaaatcaaactatttcctctgttacaaaccctgttcttcatcttttggatgatggaaatttggttctcaaagaagcacaa |
109 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2669805 |
agataatcctatatggtcatcaaatcaaactatttcctctgttacagaccctgttcttcatcttttggatgatggaaatttggttctcaaagaagcacaa |
2669904 |
T |
 |
| Q |
110 |
gagaaaaacaacagtaactatatatggcagagttttgatcatccaacagatactttgttaccaggtatgaaacttggttggaaccttgacactggtatcg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
2669905 |
gagaaaaacaacagtaactatatatggcagagttttgatcatccaacagatactttgttaccagggatgaaacttggttggaaccttgacactggtgtcg |
2670004 |
T |
 |
| Q |
210 |
agattcgaataacttcgtggaaaagtcaagatgatccatcaactggagatagtcatttcagtcttgattatcatggtgttccagatattt |
299 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2670005 |
agattcgaataacttcatggaaaagtcaagatgatccatcaactggagatagtcatttcagtcttgattatcatggtgttccagatattt |
2670094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 132 - 172
Target Start/End: Complemental strand, 2686112 - 2686072
Alignment:
| Q |
132 |
tatggcagagttttgatcatccaacagatactttgttacca |
172 |
Q |
| |
|
||||||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
2686112 |
tatggcaaagctttgattatccaacagatactttgttacca |
2686072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 132 - 193
Target Start/End: Original strand, 36360961 - 36361022
Alignment:
| Q |
132 |
tatggcagagttttgatcatccaacagatactttgttaccaggtatgaaacttggttggaac |
193 |
Q |
| |
|
||||||| ||||||||| | || ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36360961 |
tatggcaaagttttgattaccctacagatactttgttacctggtatgaaacttggttggaac |
36361022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University