View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_low_57 (Length: 280)
Name: NF16006_low_57
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_low_57 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 15 - 223
Target Start/End: Original strand, 40675661 - 40675869
Alignment:
| Q |
15 |
gagttatggtccaagcacggaatacgtggtttgtaggaacaccttcgccatgtgaagctgaagcaaacagtttaatgaagactctgatatggttacacgg |
114 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
40675661 |
gagttatggtccaagcacggaatatgtggtttgtaggaacaccttcgccatgtgaagctgaagcaaacagtttaaggcagactctgatatggttacacgg |
40675760 |
T |
 |
| Q |
115 |
caaagagaagttgcacattgagctgcaaactctgacatggttacaaggcaaagaggagtttcatgttgagctagaaacagattgcaagcaaatagtggac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40675761 |
caaagagaagttgcacattgagctgcaaactctgacatggttacaaggcaaagaggagtttcatgttgagctagaaacagattgcaagcaaatagtggac |
40675860 |
T |
 |
| Q |
215 |
tccgatatc |
223 |
Q |
| |
|
||||||||| |
|
|
| T |
40675861 |
tccgatatc |
40675869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 40684621 - 40684682
Alignment:
| Q |
15 |
gagttatggtccaagcacggaatacgtggtttgtaggaacaccttcgccatgtgaagctgaa |
76 |
Q |
| |
|
||||||||||||||||||||| | ||||||| ||||||||||||||||| | ||||||||| |
|
|
| T |
40684621 |
gagttatggtccaagcacggactgggtggtttataggaacaccttcgccaagcgaagctgaa |
40684682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University