View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_low_60 (Length: 273)
Name: NF16006_low_60
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_low_60 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 18 - 267
Target Start/End: Original strand, 3838649 - 3838898
Alignment:
| Q |
18 |
atcttttctttcagtgcccttttgcactgaaactttggacctggcttgccaatcttctcaatattaatcttcccgccattgataacatttggaagattgg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3838649 |
atcttttctttcagtgcccttttgcactgaaactttggacctggcttgctaatcttctcaatattaatcttcccgccattgataacatttggaagattgg |
3838748 |
T |
 |
| Q |
118 |
ggagcaatttacacctcagtgcaggttagtttctaaggttgcagtcatcaacactatttccatcatctcgtactcgagaaatcaagctagatttcaagac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3838749 |
ggagcaatttacacctcagtgcaggttagtttctaaggttgcagtcatcaacactatttccatcatctggtactcgagaaatcaagctagatttcaagac |
3838848 |
T |
 |
| Q |
218 |
aagcaaattcactggaggtctgctatcaattccattatttcctatgcttc |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3838849 |
aagcaaattcactggaggtctgctatcaattccattatttcctatacttc |
3838898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University