View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_low_64 (Length: 271)
Name: NF16006_low_64
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_low_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 8 - 257
Target Start/End: Original strand, 32899015 - 32899264
Alignment:
| Q |
8 |
ggagaagcaaagggtggtggttgacagtggtggtggtctcaacatgggaggattaggttcttctgagcttgattgcatgtggaactattaattaaggatt |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32899015 |
ggaggagcaaagggtggtggttgacagtggtggtggtctcaacatgggaggattaggttcttctgagcttgattgcatgtggaactattaattaaggatt |
32899114 |
T |
 |
| Q |
108 |
atgagtagtagatttaattatgtgtctatgatttcaatcaaagattttaattaggatttaacttgtttaaggttgcctaggtttgattgtactagattgt |
207 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32899115 |
atgattagtagatttaattatttgtctatgatttcaatcaaatattttaattaggatttaacttgtttaaggttgcgtaggtttgattgtactagattgt |
32899214 |
T |
 |
| Q |
208 |
tgttactactaggttttggtgtttacaagggtagttttggaattgtgttt |
257 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32899215 |
tgttactactaggttttggtgtttccaagggtagttttggaattgtgttt |
32899264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University