View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_low_68 (Length: 261)
Name: NF16006_low_68
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_low_68 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 213 - 248
Target Start/End: Original strand, 26376980 - 26377015
Alignment:
| Q |
213 |
gtgaacattttagatctatggcacactcatcattct |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
26376980 |
gtgaacattttagatctatggcacactcatcattct |
26377015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University