View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_low_77 (Length: 250)
Name: NF16006_low_77
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_low_77 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 37656533 - 37656307
Alignment:
| Q |
1 |
aacaacaaagttggactgacaaagcactcaaccaatgaagattatgtagttttgtcgaaaaatggatgcagttataatttataaacaggtttatttgata |
100 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37656533 |
aacaacagagttggactgacagagcactcaaccaatgaagattatgtagttttgtcgaaaaatggatgcagttataatttataaacaggtttatttgata |
37656434 |
T |
 |
| Q |
101 |
gtataagccggagattagagacacacctaaacacgaagagatgctccttttgtaagaatcaaacgagcttcttcgtgcgccttatccactgactcatagt |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37656433 |
gtataagccggaaattagagacacacctaaacacgaagagatgctccttttgtaagaatcaaacgagcttctt-------------------ctcatagt |
37656353 |
T |
 |
| Q |
201 |
gattaatgggtgacatattcagaattcagaatcattcttttcaccc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37656352 |
gattaatgggtgacatattcagaattcagaatcattcttttcaccc |
37656307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University