View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_low_86 (Length: 244)
Name: NF16006_low_86
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_low_86 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 8418013 - 8417795
Alignment:
| Q |
18 |
aatattcgtattcggtctcaagctcaccttagctcactctctcaaggattgtaatgtcaacctactaatgtttttgtgcgaataaaatagcttggttggt |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
8418013 |
aatattcgtattcggtctcaagcttaccttagctcactctctcaaggattgtaatgtcaacctaccaaagtttttgtccgaataaaatagcttggttggt |
8417914 |
T |
 |
| Q |
118 |
caaaagagtagtatgtggctggttcctgaagatggatgagttaaatttaatggagatggttttgatacaaattttggaggttgtgcttgtgcaacgtgtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8417913 |
caaaagagtagtatgtggctggttcctgaagatggatgagttaaatttaatggagatggttttgatacaaattttggaggttgtgcttgtgcaacgtgtg |
8417814 |
T |
 |
| Q |
218 |
gtggggttgtgcctttgct |
236 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
8417813 |
gtggggttgtgcttttgct |
8417795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University