View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_low_87 (Length: 243)
Name: NF16006_low_87
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_low_87 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 23 - 227
Target Start/End: Original strand, 2636610 - 2636814
Alignment:
| Q |
23 |
aaaaaagtgtagggtagttactagttatgttccaagttttattttattttatctagaggtagttatttttataggtagttatgttccaagttgcatagca |
122 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2636610 |
aaaacagtgtagggtagttactagttatgttccaagttttattttattttatctagaggtagttatttttataggtagttatgttccaagttgcatagca |
2636709 |
T |
|
| Q |
123 |
ttatcaaaataaattaaatgcatgatgtagaccgtacgatcagatctcatgtggctcacatcactgatgataatgaaccgacaccacgtgtcagataatt |
222 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2636710 |
ttataaaaataaattaaatgcataatgtagaccgtacgatcagatctcatgtggctcacatcactgatgataatgaaccgacaccacgtgtcagatagtt |
2636809 |
T |
|
| Q |
223 |
gtttg |
227 |
Q |
| |
|
||||| |
|
|
| T |
2636810 |
gtttg |
2636814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University