View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_low_89 (Length: 239)
Name: NF16006_low_89
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_low_89 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 226
Target Start/End: Original strand, 32960679 - 32960886
Alignment:
| Q |
19 |
aaatggccaaatggtttgtctttctttaatgctttaactggaagagctgatgatgctaaacttttgtttaatcccgatagcttaggaggaaaacaaggtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32960679 |
aaatggccaaatggtttgtctttctttaatgctttaactggaagagctgatgatgctaaacttttgtttaatccggatagcttaggaggaaaacaaggtg |
32960778 |
T |
|
| Q |
119 |
atcatgatcataatcaacatcatcacactcttaatcaaaatcctaattcagatggttcgaacccaaatgagtttttgagcttggatagtcaccatgaagg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32960779 |
atcatgatcataatcaacatcatcacactcttaatcaaaatcctaattcagatggttcgaacccaaatgagtttttgagcttggatagtcaccatgaagg |
32960878 |
T |
|
| Q |
219 |
tggaagaa |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
32960879 |
tggaagaa |
32960886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University