View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_low_95 (Length: 235)
Name: NF16006_low_95
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_low_95 |
 | |
|
| [»] scaffold1425 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 17 - 220
Target Start/End: Complemental strand, 5061341 - 5061137
Alignment:
| Q |
17 |
ttaatgcttcaattacttcttattcttcttcgttcggggatttgagaggnnnnnnnnt-atttttgaagtagaatcacggttggtgatttttggacagag |
115 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||| | ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5061341 |
ttaatgctttgattacttcttattcttcttcgttcgaggatttgagaaaagaattttttatttttgaagtagaatcacggttggtgttttttggacagag |
5061242 |
T |
|
| Q |
116 |
aagttttagaaaaaatagttgaatggaagagaaagagtgaaacaagcatgatagaaggagaggggaatgactggggggagtctgcaacggtggagaagat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5061241 |
aagttttagaaaaaatagttgaatggaagagaaagagtgaagcaagcatgatagaaggagaggggaatgactggggggagtctataacggtggagaagat |
5061142 |
T |
|
| Q |
216 |
gaaag |
220 |
Q |
| |
|
||||| |
|
|
| T |
5061141 |
gaaag |
5061137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1425 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold1425
Description:
Target: scaffold1425; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 1001 - 1086
Alignment:
| Q |
140 |
ggaagagaaagagtgaaacaagcatgatagaagg-------agaggggaatgactggggggagtctgcaacggtggagaagatgaaag |
220 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1001 |
ggaagagaaggagtgaagcaagcatgatagaaggctgaaggagaggggaatgactgggg--agtctgcaacggtggagaagatgaaag |
1086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University