View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16007_high_6 (Length: 208)
Name: NF16007_high_6
Description: NF16007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16007_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 14 - 173
Target Start/End: Complemental strand, 31799371 - 31799212
Alignment:
| Q |
14 |
gagatgaatttcaagcatgcaagcaaaagaaccaaaagtccgcttattagtatgggaagggatggctcgaaatgccactaatatagatagagtagaggtg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31799371 |
gagatgaatttcaagcatgcaagcaaaagaaccaaaagtccgcttattagtatgggaagggatggctcgaaatgccactaatatagatagagtagaggtg |
31799272 |
T |
 |
| Q |
114 |
acatttttaaaagaagaagagtctcatgaatgtgcaaataagtggttgaaaatgatacta |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31799271 |
acatttttaaaagaagaagagtctcatgaatgtgcaaataagtggttgaaaatgatacta |
31799212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University