View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16007_low_5 (Length: 222)
Name: NF16007_low_5
Description: NF16007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16007_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 7033302 - 7033081
Alignment:
| Q |
1 |
gactaaccgtgtcttgtctgttaaaatatataagtaattatctatcttcatttaatttaaacatatttgcgggcttgtttgttatttcaaatcctatgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7033302 |
gactaaccgtgtcttgtctgttaaaatatataagcaattatctatcttgatttaatttaaacatatttgcgggcttgtttgttatttcaaatcctatgtt |
7033203 |
T |
 |
| Q |
101 |
ggcattgtttgcgcactctcttagaatttgaattggagctaattcaaatcttacaatgttggtttataatgtaacgattg-------cttagaaacacat |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |||| ||||| || |
|
|
| T |
7033202 |
ggcattgtttgcgcactctcttagaatttgaattgaagctaattcaaatcttacaatgttggtttataatgtaacaattgtcatccacttacaaacaaat |
7033103 |
T |
 |
| Q |
194 |
atctcatctaaagcatggtctg |
215 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
7033102 |
atctcatctaaagcatgatctg |
7033081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University