View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16008_low_11 (Length: 297)
Name: NF16008_low_11
Description: NF16008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16008_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 13 - 283
Target Start/End: Original strand, 8765820 - 8766088
Alignment:
| Q |
13 |
agaatgtggaatcagtggatcatctgtttgtcacttgtagggtggtgtccggtgtttggtatcgtgtttgtaggtggttagggtgggagtgggttttacc |
112 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8765820 |
agaatgtggaatcagtggatcatctttttgtcacttgtagggtggtgtccggtgtttggtatcgtgtttgtaagtggttagggtgggagtgggttttacc |
8765919 |
T |
|
| Q |
113 |
taggaatcttcaagaattgcttcatatgggttagtgtctttacgtagtaggtgtagggatatactaagatttactatagtttggcattaaactgtgttat |
212 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| | |
|
|
| T |
8765920 |
taggaatcttcaggaattgcttcat--gggttagtgtctttacgtagtaggcgtagggatatactaagatttactatattttggcattaaactgtgtggt |
8766017 |
T |
|
| Q |
213 |
ccatccggaaggcccgaaatgacattattttttctggtattgcccttgaggttgatattatggttgataag |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8766018 |
ccatccggaaggcccgaaatgacattattttttctggtattgcccttgaggttgatattctggttgataag |
8766088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 112
Target Start/End: Original strand, 35005330 - 35005419
Alignment:
| Q |
23 |
atcagtggatcatctgtttgtcacttgtagggtggtgtccggtgtttggtatcgtgtttgtaggtggttagggtgggagtgggttttacc |
112 |
Q |
| |
|
||||| |||||| || ||| |||||||| |||||| ||| || |||||| ||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
35005330 |
atcaggggatcacctttttctcacttgttaggtggtttccaaggtctggtattctgtttgtaggtggctaggctgggagtgggttttacc |
35005419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University