View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16008_low_12 (Length: 289)
Name: NF16008_low_12
Description: NF16008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16008_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 3915043 - 3914773
Alignment:
| Q |
1 |
ttggaacttgagggtgtgctcgatttgattctccccgatatcaatttgtgtggactagtttagcttattcnnnnnnnnntatt--ttaagaacattgtga |
98 |
Q |
| |
|
||||||| |||||||||| ||| ||||||||||||| |||||||||||||||| |||||||| ||||||| || |||||||||||| || |
|
|
| T |
3915043 |
ttggaacctgagggtgtgttcggtttgattctccccaatatcaatttgtgtgggctagtttaacttattcaaaaaaaaataaaaattaagaacattgcga |
3914944 |
T |
 |
| Q |
99 |
aattttgtttcagactatggtggattgatatacatggaggacctcttattatttgttttttaag-nnnnnnnnnnttctagtgagatcctgtnnnnnnnn |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3914943 |
aattatgtttcagactatggtggattgatatacatggaggacctcttattatttgttttttaagaaaaaaaaaaattctagtgagatcctgtaaaaaaaa |
3914844 |
T |
 |
| Q |
198 |
ttgataaaaagatatataaaatatgagcaagattacccatgtggcttcttgatttaattttaaattagacc |
268 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3914843 |
ttgataaaaagatatagaaaatatgagcaagattacccatgtggcttcttgatttaattttaaattagacc |
3914773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University