View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16008_low_18 (Length: 214)
Name: NF16008_low_18
Description: NF16008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16008_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 9312865 - 9312668
Alignment:
| Q |
1 |
tttactggaaggtttttcttaaatggtgagattcctctttagttactgaaatttttacatggtgattgataaccattcattgaagatgcaagtgaggttt |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9312865 |
tttactggaaggtttttcttaaacggtgagattcctctttagttactgaaatttttacacggtgattgataaccattcattgaagatgcaagtgaggttt |
9312766 |
T |
 |
| Q |
101 |
tggagccctttttgtcctagtagtggtggtgttgtggagactgctagtcatgcaatgtgagattcctctgtagttacaagtcttttgactcttagctt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
9312765 |
tggagccctttttgtcctagtagtggtggtggtgtggagactgctagtcatgcaatgtgagattcctctttagttgcaagtcttttgactcttagctt |
9312668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 125 - 198
Target Start/End: Complemental strand, 9288391 - 9288318
Alignment:
| Q |
125 |
ggtggtgttgtggagactgctagtcatgcaatgtgagattcctctgtagttacaagtcttttgactcttagctt |
198 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9288391 |
ggtggtgttgtggagactgctattcatgcaatgtgagattcctctttagttacaagtcttttgactcttagctt |
9288318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University