View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16008_low_5 (Length: 403)
Name: NF16008_low_5
Description: NF16008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16008_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 168 - 272
Target Start/End: Complemental strand, 25537009 - 25536905
Alignment:
| Q |
168 |
gtcttttgagagtatgagaaagtcttaaaagagtatgattgaatttgtgggaatgttttgaggtaaggtaatcttttgtgggaattcttcgaatcttttt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
25537009 |
gtcttttgagagtatgagaaagtcttaaaagagtatgattgaatttgtgggaatgttttgaggtaaggtaatcttttgtggaaattcttcaaatcttttt |
25536910 |
T |
|
| Q |
268 |
aagta |
272 |
Q |
| |
|
||||| |
|
|
| T |
25536909 |
aagta |
25536905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 25537167 - 25537075
Alignment:
| Q |
19 |
tgtagctagtagagcttattaactctactgttgtttgagagtcatgaaatcgattttcagaagtggtattgcttaggcatatatgtacactct |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25537167 |
tgtagctagtagagcttattaactctactgttctttgagagtcatgaaatcgattttcagaagtggtattgcttaggcatatatgtacactct |
25537075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University