View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16009_low_5 (Length: 220)
Name: NF16009_low_5
Description: NF16009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16009_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 13 - 181
Target Start/End: Original strand, 6307659 - 6307820
Alignment:
| Q |
13 |
gaagaatattgtgggaaaattattcaatcaataatatttgttgcttttctctattttgtgtttgactttgtctaattccactcaaccaattttatagtgg |
112 |
Q |
| |
|
|||||| ||||| |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6307659 |
gaagaaaattgttggaaaactatttaatcaataatatttgttgcttttctctattttgtgtttgactttgtctaattccactaaaccaattttatagtgg |
6307758 |
T |
 |
| Q |
113 |
atagcttgcttgaaatttgaataggatgcttcggggattaagatcagttcctattacttctccatatac |
181 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6307759 |
atagcttgc-------ttgaataggatgcttcggggattaagatcagttcctattacttctccatatac |
6307820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University