View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1600_low_12 (Length: 242)
Name: NF1600_low_12
Description: NF1600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1600_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 146 - 237
Target Start/End: Original strand, 3021888 - 3021979
Alignment:
| Q |
146 |
gttgatctttatatatgtaagtgatgtaatctcttgatttaaactacatttctcatattcaatacaattttcatttcattttataacctatg |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3021888 |
gttgatctttatatatgtaagtgatgtaatctcttgatttaaactacatttctcatattcgatacaattttcatttcattttataacctatg |
3021979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 10 - 98
Target Start/End: Original strand, 3021752 - 3021840
Alignment:
| Q |
10 |
agttaagtttgaaataatattgaagtcgcacataaacatagtttgttggattgaacatgaaacttgaaccacctaccatataaagagat |
98 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3021752 |
agttcagtttgaaataatattgaagtcgcacataaacatagtttgttggattgaacatgaaacttgaaccacctactatataaagagat |
3021840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University