View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16010_high_20 (Length: 235)
Name: NF16010_high_20
Description: NF16010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16010_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 20 - 220
Target Start/End: Complemental strand, 7473173 - 7472971
Alignment:
| Q |
20 |
atcagatcttattgggttgctagttcaaatttattgaagtgagggtattaattaccaatgatatgcccgtaaaaatgtactaactaacaaatgacctgta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7473173 |
atcagatcttattgggttgctagttcaaatttattgaagtgagggtattaattaccaatgatatgcccgtaaaaatgtactaactaacaaatgacctgta |
7473074 |
T |
 |
| Q |
120 |
gcttacgacttcgtttcat--tagcaaaggtatctatattcaaatttaaccataacaatacctacatgagaaagagagacaaaaattaccaatctcgtct |
217 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7473073 |
gcttacgacttcgtttcattatagcaaaggtatctatattcaaatttaaacataacaatacctacatgagaaagagagacaaaaattaccaatctcgtct |
7472974 |
T |
 |
| Q |
218 |
gtg |
220 |
Q |
| |
|
||| |
|
|
| T |
7472973 |
gtg |
7472971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 25 - 112
Target Start/End: Original strand, 5367777 - 5367863
Alignment:
| Q |
25 |
atcttattgggttgctagttcaaatttattgaagtgagggtattaattaccaatgatatgcccgtaaaaatgtactaactaacaaatg |
112 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||| ||||||||| |||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
5367777 |
atcttattggattgctagttcaaatttattaaagtgaggggattaattactaatgatatgccc-taaaaaagtactaactaacaaatg |
5367863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 140 - 219
Target Start/End: Original strand, 5367959 - 5368038
Alignment:
| Q |
140 |
agcaaaggtatctatattcaaatttaaccataacaatacctacatgagaaagagagacaaaaattaccaatctcgtctgt |
219 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||| | ||| |||||| |||||||||||||| || |||||||| ||||| |
|
|
| T |
5367959 |
agcagaggtacctatattcaaatttaaccataatagtacttacatgtgaaagagagacaaagcttgccaatctcctctgt |
5368038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 18924687 - 18924754
Alignment:
| Q |
20 |
atcagatcttattgggttgctagttcaaatttattgaagtgagggtattaattaccaatgatatgccc |
87 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||| || ||||||||| | |||||||||| |
|
|
| T |
18924687 |
atcaaatcttattaggttgctagttcaaatttattgaagtgaagggattaattactagtgatatgccc |
18924754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 140 - 218
Target Start/End: Original strand, 20451661 - 20451739
Alignment:
| Q |
140 |
agcaaaggtatctatattcaaatttaaccataacaatacctacatgagaaagagagacaaaaattaccaatctcgtctg |
218 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||| | ||| |||||| |||| ||||||||| || |||||||| |||| |
|
|
| T |
20451661 |
agcagaggtacctatattcaaatttaaccataatagtacttacatgtgaaaaagagacaaagcttgccaatctcctctg |
20451739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University