View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16010_high_9 (Length: 370)
Name: NF16010_high_9
Description: NF16010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16010_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 359
Target Start/End: Original strand, 38894500 - 38894837
Alignment:
| Q |
23 |
gagatgtcaggtgagaacgaagaggaagccggaaccaatggagagttggagcaatctcattctcataacagaactgtttcacatgtttagattgagttta |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38894500 |
gagatgtcaggtgagaacgaagaggaagccggaaccaatggagagttggagcaatctcattctcataacagaactgtttcacatgtttagattgagttta |
38894599 |
T |
 |
| Q |
123 |
attagtttgttt-atcttgtaataaagcactatctttcaatttgtttaggatgcaccaaagctctcccttcccctgtcacgtctttatctcggattatgt |
221 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38894600 |
attagtttgttttatcttgtaataaagcactatctttcaatttgtttaggatgcaccaaagctctcccttcccctgtcacgtctttatcccggattatgt |
38894699 |
T |
 |
| Q |
222 |
ttgatgaaccattagttctacaaatatcaaatgcaatgttgcaattgatgtttaatttttggatttaatagttagtagtttcgattcattttcaataacc |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38894700 |
ctgatgaaccattagttctacaaatatcaaatgcaatgttgcaattgatgtttaatttttggatttaatagttagtagtttcgattcattttcaaaaacc |
38894799 |
T |
 |
| Q |
322 |
agtttcgactgtgttctgttttcttttcctttgctact |
359 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
38894800 |
agtttcgactgtgttctattttcttttcctttgttact |
38894837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University