View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16010_low_12 (Length: 354)

Name: NF16010_low_12
Description: NF16010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16010_low_12
NF16010_low_12
[»] chr8 (2 HSPs)
chr8 (132-205)||(15112686-15112759)
chr8 (303-340)||(15112940-15112977)


Alignment Details
Target: chr8 (Bit Score: 62; Significance: 1e-26; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 132 - 205
Target Start/End: Original strand, 15112686 - 15112759
Alignment:
132 ggacattagtattaggtttagccattaaaacacataaagagaatggaactgaggtgtagaaacaaagagagaag 205  Q
    |||||||||||||||||||||||||||||||||||| |||||||||  ||||||||||||||||||||||||||    
15112686 ggacattagtattaggtttagccattaaaacacatagagagaatggggctgaggtgtagaaacaaagagagaag 15112759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 303 - 340
Target Start/End: Original strand, 15112940 - 15112977
Alignment:
303 agatgtaacaatatttattgctggagctctagaattat 340  Q
    |||||||| |||||||||||||||||||||||||||||    
15112940 agatgtaaaaatatttattgctggagctctagaattat 15112977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University