View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16010_low_21 (Length: 247)
Name: NF16010_low_21
Description: NF16010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16010_low_21 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 17 - 247
Target Start/End: Original strand, 5646389 - 5646621
Alignment:
| Q |
17 |
acttatggcaacttatttaatctttattcttaattttgttcattgttgaccgcttttaattgatttatgattaacgttgaaattcagctttgtgaatgtt |
116 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5646389 |
acttatgggaacttatttaatctttattcttaattttgttcattgttgaccgcttttaatcgatttatgattaacgttgaaattcagctttgtgaatgtt |
5646488 |
T |
|
| Q |
117 |
tagtttaaagattcacgactttatagtcaagagattgatgc--gatcatgcatgagatttgggattatcttaagacaataactaagagattaggattaga |
214 |
Q |
| |
|
||| ||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5646489 |
tagcttaaatattcacgactttatagtcaagagattgatgcgtgctcatgcatgagatttgggattatcttaagacaataactaagagattaggattaga |
5646588 |
T |
|
| Q |
215 |
cactacataaaatttatgacaatgcgatgaatc |
247 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||| |
|
|
| T |
5646589 |
cactatataaaatttatgacaatgcaatgaatc |
5646621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University