View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16010_low_23 (Length: 237)
Name: NF16010_low_23
Description: NF16010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16010_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 14 - 219
Target Start/End: Original strand, 138852 - 139057
Alignment:
| Q |
14 |
agaagaagcagaaggttgttgggaaatgaaatgaagatagttattattattgttgtgagtattgaagtagtgaatgtgagaagttgtggttaaaccaatg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
138852 |
agaagaagcagaaggttgttgggaaatgaaatgaagatagttattattattgttgtgagtattgaagtagtgaatgtgagaagttgtggttaaaccaatg |
138951 |
T |
 |
| Q |
114 |
acgacaccagcagcaaaaacaagcaacaatgtaacaagttgttgtaccaatctaaccaaaccagagtgctgttgctgcttcgtcggatctctgtctcctt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
138952 |
acgacaccagcagcaaaaacaagcaacaatgtaacaagttgttgtaccaatctaaccaaaccagagtgctgttgctgcttcgtcggatctctgtctcctt |
139051 |
T |
 |
| Q |
214 |
cttctc |
219 |
Q |
| |
|
|||||| |
|
|
| T |
139052 |
cttctc |
139057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University