View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16011_high_34 (Length: 231)
Name: NF16011_high_34
Description: NF16011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16011_high_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 33239262 - 33239479
Alignment:
| Q |
1 |
agaatggcaagatatgaatctgaga-agggaagaggttactactataagtttgctatatgcttaatttgggagtttgaagtttttgaatttctgtaattg |
99 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33239262 |
agaatggcaagatatgaatctgagagaaggaagaggttactactataagtttgctatatgcttaatttgggagtttgaagtttttgaatttctgtaattg |
33239361 |
T |
 |
| Q |
100 |
tctacatttttctatatttatgcatgtgtgtatgaatgaagatgaaagtctagtgccatgtaaccaccttgtttactctttgatgcaagggcatggaaaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
33239362 |
tctacatttttctatatttatgcatgtgtgtatgaatgaagatgaaagtctagtgccatgtaaccaccttgtttactctttgatgcaaggg--tggtaaa |
33239459 |
T |
 |
| Q |
200 |
taaattatggcttcatttca |
219 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33239460 |
taaattatggcttcatttca |
33239479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University