View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16011_low_11 (Length: 397)
Name: NF16011_low_11
Description: NF16011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16011_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 16 - 388
Target Start/End: Original strand, 46501387 - 46501759
Alignment:
| Q |
16 |
atatggtgaatgtctcattttttagattagatattcctcctcttctcttcatgaatgcactcaaattcatgacaattatgcaacttttggactcnnnnnn |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46501387 |
atatggtgaatgtctcattttttagattagatattcctcctcttctcttcatgaatgcactcaaattcatgacaattatgcaacttttggactcaaaaga |
46501486 |
T |
 |
| Q |
116 |
nnnnnnnnnngttgcaagttggattgatactataaacctatttgaatatgtgctttccttctcctctttattcaccttgttggtaaaaattatgttgatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46501487 |
aaagaaaaaagttgcaagttggattgatactataaacctatttgaatatgtgctttccttctcctctttattcaccttgttggtaaaaattatgttgatg |
46501586 |
T |
 |
| Q |
216 |
atggtatatgctcccccactattcataaagtctttgcaattaattaattaatcatgataggttcattaattcctgctgccactgcaagagcatacttggg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46501587 |
atggtatatgctcccccactattcataaagtctttgcaattaattaattaatcatgataggttcattaattcctgctgccactgcaagagcatacttggg |
46501686 |
T |
 |
| Q |
316 |
tttgggtttcgacaatcacaacaattattgcataacacgtagccagcatctacatatccgtctgctttcatat |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46501687 |
tttgggtttcgacaatcacaacaattattgcataacacgtagccagcatctgcatatccgtctgctttcatat |
46501759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University