View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16011_low_21 (Length: 295)
Name: NF16011_low_21
Description: NF16011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16011_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 12 - 268
Target Start/End: Complemental strand, 34869837 - 34869565
Alignment:
| Q |
12 |
atgaaccaattgtttgtcatacatgaaattttataaacacctctacaattgaaaacattaactagtcttcatatctcatatgaatatgagtagctaaatg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34869837 |
atgaaccaattgtttgtcatacatgaaattttataaacacctctacaattgaaaacattaactagtcttcgtatctcatatgaatatgagtagctaaatg |
34869738 |
T |
|
| Q |
112 |
tattagactatggttttataagcctccttttcttcaattttctttgcatgacaatgaagtgtaacttacaacaaagtattcaactcagt----------- |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
34869737 |
tattagactatggttttataagcctccttttcttcaattttctttgcatgacaatcaagtgtaacttacaacaaagtattcaactgagtctcaactgatg |
34869638 |
T |
|
| Q |
201 |
-----ctcaactcgtcaaatgagtagttatcattttttgggacactgagagcttatgaaagacacgaaaacac |
268 |
Q |
| |
|
|||||||||||||||||||| |||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34869637 |
aagcactcaactcgtcaaatgagtaattattatttattgggacactgagagcttatgaaagacacgaaaacac |
34869565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University