View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16011_low_28 (Length: 248)
Name: NF16011_low_28
Description: NF16011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16011_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 3765338 - 3765571
Alignment:
| Q |
1 |
ttgtcacgcattgcagtcttacccggctaagggactactctttgcagttgtgcgcagaggatacccggctcattccactaactactactacctttgttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3765338 |
ttgtcacgcattgcagtcttacccggctaagggactactctttgcagttgtgcgcagaggatacccggctcattccactaactactactacctttgttgt |
3765437 |
T |
 |
| Q |
101 |
ccataaataaatgactcatttcaaattactagatacannnnnnnaaaaatataccccttattaatacaactaatttgtcatgggagatgaaaaaactgag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3765438 |
ccataaataaatgactcatttcaaattactagatacatttttttaaaaatataccccttattaatacaactaatttgtcatgggagatgaaaaaactgag |
3765537 |
T |
 |
| Q |
201 |
ttggtcacatctatacaaaacaaggtattttagt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
3765538 |
ttggtcacatctatacaaaacaaggtattttagt |
3765571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University