View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16012_low_8 (Length: 259)
Name: NF16012_low_8
Description: NF16012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16012_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 111 - 217
Target Start/End: Original strand, 49552614 - 49552714
Alignment:
| Q |
111 |
aagataaataaaatagacaccatccgtgccttaattatactgtaagtgtaacatctgctaccagattaccgaaatgcagttatgacaaatgtgtaggcca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49552614 |
aagataaataaaatagacaccatccgtgccttaattatactgta------acatctgctactagattaccgaaatgcagtcatgacaaatgtgtaggcca |
49552707 |
T |
|
| Q |
211 |
tgggtac |
217 |
Q |
| |
|
||||||| |
|
|
| T |
49552708 |
tgggtac |
49552714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 39 - 113
Target Start/End: Original strand, 49552511 - 49552585
Alignment:
| Q |
39 |
tgttttacaccttgacggcaaatttagtttgcttctgtagtgtgatttggatcatgttcatgtttctaatctaag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49552511 |
tgttttacaccttgacggcaaatttagtttgcttctgtagtgtgatttggatcatgttcatgtttctaatctaag |
49552585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University