View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16013_low_14 (Length: 267)
Name: NF16013_low_14
Description: NF16013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16013_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 25 - 253
Target Start/End: Original strand, 34669670 - 34669898
Alignment:
| Q |
25 |
gttgctggtcctaatgtttggcaaccttcacaacccaattatttgcaaagtcttgcaagtagttctgggactaaagtgactgtggatcataatattatta |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34669670 |
gttgctggtcctaatgtttggcaaccttcacaacccaattatttgcaaagtcttgcaagtagttctgggactaaagtgactgtggatcataatattatta |
34669769 |
T |
|
| Q |
125 |
ccaatcaacatatgggaatgcaaggagaaggtcagcagcattctaactattattcttttggacactgtaaggaattcttttcactgcttttgtctcttgt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34669770 |
ccaatcaacatatgggaatgcaaggagaaggtcagcagcattctaagtattattcttttggaaactgtaaggaattcttttcactgcttttgtctcttgt |
34669869 |
T |
|
| Q |
225 |
tggaattgatatttgtgcaccatattctt |
253 |
Q |
| |
|
||||||||||||||||||||||| ||||| |
|
|
| T |
34669870 |
tggaattgatatttgtgcaccattttctt |
34669898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University