View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16013_low_15 (Length: 264)
Name: NF16013_low_15
Description: NF16013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16013_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 254
Target Start/End: Original strand, 24307362 - 24307598
Alignment:
| Q |
18 |
ggattttggtcgcgatggttggtttagtggtagggttaagacatttccatggtatttggtaagaatgcatggttgatcggtgaagaattgtaacgacggt |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24307362 |
ggattttggtcgcaatggttggtttagtggtagggttaagacatttccatggtatttggtaagaatgcatggttgatcggtgaagaattgtaacaacggt |
24307461 |
T |
|
| Q |
118 |
ggtggttgttggattgctttagggtgaagctaggtgacggtgaacaatgatagaaacaaagttatattcgccagactttctcccacatctctctaacatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| ||||||||| |||||||||||||||||| | |
|
|
| T |
24307462 |
ggtggttgttggattgctttagggtgaagctaggtgacgatgaacaatgatagaaacaatgttatattctccagactttttcccacatctctctaacagt |
24307561 |
T |
|
| Q |
218 |
ttgcttgttcccaatgaactaatatatcatatgagta |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24307562 |
ttgcttgttcccaatgaactaatatatcatatgagta |
24307598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University