View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16013_low_7 (Length: 392)
Name: NF16013_low_7
Description: NF16013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16013_low_7 |
 |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0008 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 337
Target Start/End: Complemental strand, 53275 - 52942
Alignment:
| Q |
13 |
aaaatatacgtatctctcgttttattttttataacaaaaatatccacatttcctcctacaatctctctctgagcccaaatcttttcaannnnnnnggtaa |
112 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53275 |
aaaatatacttatctctcgttttattttttgtaacaaaaatatccacatttcctcctagaatctctctctgagcccaaatcttttcaatttttttggtaa |
53176 |
T |
 |
| Q |
113 |
caaactgagtctttaaaaaacactgagcattgtttgtttcttatacggttgttaagt--tatatatattagagtctcagagttgaaagtgtgttttcatc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
53175 |
caaactgagtctttaaaaaacactgagcattgtttgtttcttatacggttgtttagtgctatatatattagagtctc--agttgaaagtgtattttcatc |
53078 |
T |
 |
| Q |
211 |
ttttacaggtc-tttttctttcacgtaggtannnnnnnctttcacgttatgtc---acttatca-----tggtatattgtttttctgcttgatttatcgt |
301 |
Q |
| |
|
|||| ||||| ||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
53077 |
gtttataggtcttttttctttcacgtaggtatttttttctttcacgttatgtcactacttatcacttactggtatattgtttttctgctcgatttatcgt |
52978 |
T |
 |
| Q |
302 |
gagtttcattacaaaccggttatgtgaagaaatcga |
337 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||| |
|
|
| T |
52977 |
gagtttcattacaaatcgtttatgtgaagaaatcga |
52942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University