View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16014_low_4 (Length: 216)
Name: NF16014_low_4
Description: NF16014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16014_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 3 - 207
Target Start/End: Original strand, 32196601 - 32196802
Alignment:
| Q |
3 |
gttcaacaatttgcagatgagatgtgaattagctttttgatgaatttttgatgaagtttcatgaaataaaatggttcctgnnnnnnnnctctatattcac |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32196601 |
gttcaacaatttgcagatgagatgtgaattagctttttgatgaatttt-gatgaagtttcatgaaataaaatggttcctgaaaaagc-ctctatattcac |
32196698 |
T |
 |
| Q |
103 |
ttgccttcacataataaattagcaccaaaagacaatctaataaaaagaggtaagtctatctattcattttgaatttacacttttgggaaaggtttgggat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32196699 |
ttgccttcacataataaattagcaccaaaagacaatctaatgaaaagaggtaagtctatctattcattttgaatttacactttt-ggaaaggtttgggat |
32196797 |
T |
 |
| Q |
203 |
gatgt |
207 |
Q |
| |
|
||||| |
|
|
| T |
32196798 |
gatgt |
32196802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University