View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16015_high_8 (Length: 251)
Name: NF16015_high_8
Description: NF16015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16015_high_8 |
 | |
|
| [»] scaffold0018 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 17233582 - 17233821
Alignment:
| Q |
1 |
tcaagtcgaaatagtttgtattagtcaagaatagttgaacccgagttagtaatttatttggtggacatgtcagaaaataaatgtcttaaaattgttgaaa |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17233582 |
tcaagtcgaaatagtttgtatcagtcaagaatagttgaacccgagttagtaatttatttggtggacatgtcagaaaataaatgtcttaaaattgttgaaa |
17233681 |
T |
|
| Q |
101 |
ccaaagttaaaatccttcaaaagtattgtagccaccgaggaggctattggactgattcgttgactaggttggtctctttaagaagtttcgtagaacta-c |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17233682 |
ccaaagttaaaatccttcaaaagtattgtagccactgaggaggctattggactgattcgttgactaggttggtctctttaagaagtttcgtagaactacc |
17233781 |
T |
|
| Q |
200 |
ctaaaattttgcaagcaaattatcaatcacaacgtcccta |
239 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17233782 |
ctaaaattttgcaagcaaactatcaatcacaacgtcccta |
17233821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 162 - 236
Target Start/End: Complemental strand, 171802 - 171728
Alignment:
| Q |
162 |
gactaggttggtctctttaagaagtttcgtagaactacctaaaattttgcaagcaaattatcaatcacaacgtcc |
236 |
Q |
| |
|
|||||||| | ||||||||||| ||||||| | ||| ||||||||| |||||||| | |||||| ||| |||||| |
|
|
| T |
171802 |
gactaggtcgctctctttaagacgtttcgtggcactgcctaaaattgtgcaagcagactatcaaccacgacgtcc |
171728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University