View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16015_low_2 (Length: 463)
Name: NF16015_low_2
Description: NF16015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16015_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 407; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 407; E-Value: 0
Query Start/End: Original strand, 19 - 456
Target Start/End: Original strand, 27053293 - 27053731
Alignment:
| Q |
19 |
cacatcatctaccgcagctggtgtactcgtagaaagtacaagctttaagggactggctaaaggatcagcaagaggcggtgctccatcagcttggttagct |
118 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27053293 |
cacatcatctaccgcagccggtgtactcgtagaaagtacaagctttaagggactggctaaaggatcagcaagaggcggtgctccatcagcttggttagct |
27053392 |
T |
 |
| Q |
119 |
gtctacaaaatttgt-ggtcaactggaggctgcagctctgccgaccttcttgcagcattcgatgatgcaatatttgatggagttgagattatttcggcgt |
217 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
27053393 |
gtctacaaaatttgttggtcaactggaggctgcagctctgccgaccttcttgcagcattcgatgatgcaatatttgatgaagttgagattatttcggtgt |
27053492 |
T |
 |
| Q |
218 |
ctctcggctcatatcctccacttcctagttatgttgaggatgtgttggccattggttccttccatgctgttgctaaaggagtttctgttgtatgctccgg |
317 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27053493 |
ctctcggctcgtatcctccacttcctagttatgttgaggatgtgttggccattggttccttccatgctgttgctaaaggagtttctgttgtatgctccgg |
27053592 |
T |
 |
| Q |
318 |
tggtaattctggaccatatgctcaaactgtcataaacactgctccttgggttattaccgtcgctgctagtaccaccgatagagaatttctgtctacaatt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
27053593 |
tggtaattctggaccatatgctcaaactgtcataaacactgctccttgggttattaccgtcgctgctagtaccatcgatagagaatttccgtctacaatt |
27053692 |
T |
 |
| Q |
418 |
atcttgggaaataatcaaactatacaggtacttcatctc |
456 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27053693 |
atcttgggaaataatcaaactatacaggtacttcatctc |
27053731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University