View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16016_high_15 (Length: 293)
Name: NF16016_high_15
Description: NF16016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16016_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 31 - 283
Target Start/End: Complemental strand, 8406450 - 8406198
Alignment:
| Q |
31 |
gtctcttttaagttctaataatgcaattttgaatcatataacaggatggtccactgatgaattataggtttcacgtattaagtgcttggcttcttgtcct |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8406450 |
gtctcttttaagttctaataatgcaattttgaatcatataacaggatggtccactgatgaattataggtttcacgtattaagtgcttggcttcttgtcct |
8406351 |
T |
|
| Q |
131 |
tgcttttcttctgttgctaatttttataatgtgaaaacgtttacttgattgacctgtccttatcacatgagatgatgatcgtttacttggttgactcaat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8406350 |
tgcttttcttctgttgctaatttttataatgtgaaaacgtttacttgattgacctgtccttatcacatgagatgatgatcgtttacttggttgactcaat |
8406251 |
T |
|
| Q |
231 |
gtttcccataatgctagttgacttggtccatatcatccaaacgtgtttttcat |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8406250 |
gtttcccataatgctagttgacttggtccatatcatccaaacgtgtttttcat |
8406198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University