View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16016_high_20 (Length: 219)
Name: NF16016_high_20
Description: NF16016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16016_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 19 - 210
Target Start/End: Complemental strand, 6313978 - 6313787
Alignment:
| Q |
19 |
gccctgaggtgcaacaagcagcattaaatggaaggaatttgcttgggtttggggagcatacagacccacaagtcatttctgtcttgagatctaatagcac |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6313978 |
gccctgaggtgcaacaagcagcattgaatggaaggaatttgcttgggtttggggagcatacagacccacaagtcatttctgtcttgagatctaatagcac |
6313879 |
T |
 |
| Q |
119 |
atcaggactgcaaatctgtctcactgatggaacttgggtttcagttccacctgatcacacttcttttttcatcaatgttggtgatattcttc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6313878 |
atcaggactgcaaatctgtctcactgatggaacttgggtttcagttccacctgatcacacttcttttttcatcaatgttggtgatactcttc |
6313787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 54 - 202
Target Start/End: Original strand, 38545355 - 38545503
Alignment:
| Q |
54 |
aatttgcttgggtttggggagcatacagacccacaagtcatttctgtcttgagatctaatagcacatcaggactgcaaatctgtctcactgatggaactt |
153 |
Q |
| |
|
|||||| |||| |||||||||||||| |||||||| | || |||||| | || ||||||| |||||||||||||||| ||||||| ||||| |||| |
|
|
| T |
38545355 |
aatttgattggatttggggagcatactgacccacagataatatctgtcctaaggtctaataatgcatcaggactgcaaatttgtctcagagatgggactt |
38545454 |
T |
 |
| Q |
154 |
gggtttcagttccacctgatcacacttcttttttcatcaatgttggtga |
202 |
Q |
| |
|
|||||||| | |||||||||||||||||||| ||||| | ||||||||| |
|
|
| T |
38545455 |
gggtttcaatcccacctgatcacacttctttcttcataagtgttggtga |
38545503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University