View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16016_high_22 (Length: 214)
Name: NF16016_high_22
Description: NF16016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16016_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 16 - 196
Target Start/End: Original strand, 55058083 - 55058258
Alignment:
| Q |
16 |
atgaatgtggtcgaggggctttctgtgtttttatattgcaagagtatataaaatagtcaatagctttgctttgcaataaaaaaccaatctgttagtctcg |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
55058083 |
atgaatgtggtcaaggggctttctgtgtttttatattgcaagagtatataaaatagtcaatagctgtgctttgcaataaaaaaccaatctgttggtctc- |
55058181 |
T |
 |
| Q |
116 |
tttggtttggttaatactagcagtgctcaannnnnnngaaaaagcagttatcataattactcgaaaattcgtagttattat |
196 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55058182 |
----gtttggttaatactggcagtgctcaatttttttgaagaagcagttatcataattactcgaaaattcgtagttattat |
55058258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University