View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16016_low_14 (Length: 365)
Name: NF16016_low_14
Description: NF16016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16016_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 8e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 16 - 192
Target Start/End: Original strand, 43386087 - 43386260
Alignment:
| Q |
16 |
ttcttcacaccacatctttcacctgaacacttgtagtagttcctgcatgtatatgagcacatctttaattaacttaataatttaaagaagaagtatttga |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43386087 |
ttcttaacaccacatctttcacctgaacacttgtagtagttcctgcatgtatatcagcacatctttaattaacttaataatttaaagaagaagtatttga |
43386186 |
T |
|
| Q |
116 |
ttaaatattttgttgtttctcaaaaccacctgataagatcaacaacagtcccagtgcacagaatctctctctttcag |
192 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43386187 |
ttaaatattttgttgtttctcaacaccacctgataagat---caacagtcccagtgcacagaatctctctctttcag |
43386260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 222 - 365
Target Start/End: Original strand, 43386290 - 43386433
Alignment:
| Q |
222 |
aataatgcaaaagtgccattatttacgggggactagctacctagcaagtgggatcgatgctgatcttacatatacatacactcatatatgtttatagaga |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43386290 |
aataatgcaaaagtgccattatttacgggggactagctacctagcaagtgggatcgatgctgatcttacatatacatatactcatatatgtttatagaga |
43386389 |
T |
|
| Q |
322 |
aagaataattaattgtcttaactgcagcaaattgaaacatcaac |
365 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43386390 |
aagaataattaattgtcttaaccgcagcaaattgaaacatcaac |
43386433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University