View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16016_low_18 (Length: 275)
Name: NF16016_low_18
Description: NF16016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16016_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 27268618 - 27268874
Alignment:
| Q |
1 |
aagaagatgtcttaagcaacaatattgttatcaatgtgacatttgaaactagggttgaaacaaccggggaatcaagcgatgaatcgaattacaaggagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27268618 |
aagaagatgtcttaagcaacaatattgttatcaatgtgacatttgaaactagggttgaaacaaccggggaatcaagcgatgaatcgaattacaaggagca |
27268717 |
T |
|
| Q |
101 |
aataatcgatgatccaacggttacaaatgatgagatacaaattgagatgggttcggtttcaactgaacctggaagctatcatcaaattagtccttggaag |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27268718 |
aataatcgatgatccaacggttacgaatgatgagatacaaattgagatgggtttggtttcaactgaacctggaagctatcatcaaattagtccttggaag |
27268817 |
T |
|
| Q |
201 |
cttattactgnnnnnnntagcaaatcaacacgtcgttctccaattgaagagcgttta |
257 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27268818 |
cttattactgaaaaaaatagcaaatcaacacgtcgttctccaattgaagagcgttta |
27268874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University