View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16016_low_21 (Length: 237)
Name: NF16016_low_21
Description: NF16016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16016_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 47436714 - 47436943
Alignment:
| Q |
1 |
agaccagaggaaatacacatttatttttaagggttcaccatgcatgtaagatctcacatttcaatagggttttcataatcctttaccttaatttggttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47436714 |
agaccagaggaaatacacatttatttttaagggttcaccgtgcatgtaagatctcaaatttcaatagggttttcataatcctttaccttaatttggttgc |
47436813 |
T |
 |
| Q |
101 |
gcttgttttgaaaccagaacttgatttgcgtcggtgtaagacctagctcacaactcaattgtttcctttgcttgccattagggagagggcattgctcgaa |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47436814 |
gcttgttttgaaactagaacttgatttgcgcaggtgtaaggcctagctcacaactcaattgtttcctttgcttgccattagggagagggcattgctcgaa |
47436913 |
T |
 |
| Q |
201 |
gaacctgaaaacatcacaaattgatgatgt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47436914 |
gaacctgaaaacatcacaaattgatgatgt |
47436943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University