View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16016_low_24 (Length: 215)
Name: NF16016_low_24
Description: NF16016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16016_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 16 - 189
Target Start/End: Original strand, 7461837 - 7462010
Alignment:
| Q |
16 |
aatattaaattatatgtattttatgtatgtacttcttcattttacaaaccatatatactttaatctacaatggacatcaannnnnnnncttttatgaggg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7461837 |
aatattaaattatatgtattttatgtatgtacttcttcattttacaaaccatatatactttaatctacaatggacatcaattttttttcttttatgaggg |
7461936 |
T |
 |
| Q |
116 |
agtgcttcaagataatgatcagatttagatgggaggttgcggattgaatgaagacgttgattatttacttgtta |
189 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7461937 |
agtgcttcaagataatgatcagatttaaacgggaggttgcggattgaatgaagacgttgatcatttacttgtta |
7462010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University