View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16016_low_26 (Length: 210)
Name: NF16016_low_26
Description: NF16016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16016_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 14 - 195
Target Start/End: Original strand, 33996022 - 33996203
Alignment:
| Q |
14 |
agatgaaggtcataaacaagctgtggaatacatcaatgcaaatggggcaaagctctcctactaacggggtatcaatttcagtatagattgtcatttcatt |
113 |
Q |
| |
|
||||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33996022 |
agatgaaggtcataagcgagctgtgggatacatcaatgcaaatggggcaaagctctcctactaacggggtatcaatttcagtatagattgtcatttcatt |
33996121 |
T |
 |
| Q |
114 |
agcaagatcttatctcgatatattaccgctaccttcataaattcaaattatcaacagctaggtttcttcacaaagtcattaa |
195 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33996122 |
agcaagatcttatctcgatatattaccactaccttcataaattcaaattatcaacagctaggtttcttcacaaagtcattaa |
33996203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University