View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16016_low_3 (Length: 533)
Name: NF16016_low_3
Description: NF16016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16016_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 2e-38; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 401 - 494
Target Start/End: Original strand, 4292947 - 4293040
Alignment:
| Q |
401 |
caattgcatagtatttgctttttatcacccttcaattcattttgtgtgtcatgatgaatgcctcttcaactatctatgtgtgtaccgtcttgtc |
494 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4292947 |
caattgcatggtatttgctttttatctcccttcaattcattttgtgtgtcatgatgaatgcctcttcaactttctatgtgtgtaccgtcttgtc |
4293040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 68 - 121
Target Start/End: Complemental strand, 38376475 - 38376418
Alignment:
| Q |
68 |
attgtttggtacaagagaataaagagagaaata----aaaaagaagtgtgtttaattt |
121 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| | ||||||||||||||||||| |
|
|
| T |
38376475 |
attgtttggtacaagagaagaaagagagaaatagaggagaaagaagtgtgtttaattt |
38376418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 74; Significance: 1e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 401 - 486
Target Start/End: Complemental strand, 29546287 - 29546202
Alignment:
| Q |
401 |
caattgcatagtatttgctttttatcacccttcaattcattttgtgtgtcatgatgaatgcctcttcaactatctatgtgtgtacc |
486 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29546287 |
caattgcatagtatttgctttttatctcccttgaattcattttgtgtgtcatgatgaatgcctcttcaactttctatgtgtgtacc |
29546202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000008; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 64 - 132
Target Start/End: Complemental strand, 33249594 - 33249520
Alignment:
| Q |
64 |
acatattgtttggtacaagagaataaagagagaaata----aaaaagaagtgtgtttaa--tttgaaaagactaa |
132 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| | |||||||||||||||| |||||||||||||| |
|
|
| T |
33249594 |
acatattgtttggtacaagagaagaaagagagaaatagaagagaaagaagtgtgtttaatttttgaaaagactaa |
33249520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 66 - 121
Target Start/End: Original strand, 2836408 - 2836467
Alignment:
| Q |
66 |
atattgtttggtacaagagaataaagagagaaata----aaaaagaagtgtgtttaattt |
121 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| | ||||||||||||||||||| |
|
|
| T |
2836408 |
atattgtttggtgcaagagaagaaagagagaaatagaggagaaagaagtgtgtttaattt |
2836467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 68 - 100
Target Start/End: Original strand, 46290520 - 46290552
Alignment:
| Q |
68 |
attgtttggtacaagagaataaagagagaaata |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
46290520 |
attgtttggtacaagagaagaaagagagaaata |
46290552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 66 - 141
Target Start/End: Original strand, 33572030 - 33572111
Alignment:
| Q |
66 |
atattgtttggtacaagagaataaagagagaaata----aaaaagaagtgtgtttaa--tttgaaaagactaagatgtcctc |
141 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||| | | |||||||||||||| |||||||||||||| || ||||| |
|
|
| T |
33572030 |
atattgtttggtacatgagaagaaagagagaaatagaagagagagaagtgtgtttaatttttgaaaagactaaaatatcctc |
33572111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University