View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16017_low_5 (Length: 219)
Name: NF16017_low_5
Description: NF16017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16017_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 14 - 156
Target Start/End: Complemental strand, 11308004 - 11307862
Alignment:
| Q |
14 |
tctaaaattatatgcatgatcagattatacaaacatgaaaatttgtacnnnnnnnaagagcaaaaatttgtactttttattcttcgaataataaaaaata |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11308004 |
tctaaaattatatgcatgatcagattatataagcatgaaaatttgtactttttttaaaagcaaaaatttgtactttttattcttcgaataataaaaaata |
11307905 |
T |
|
| Q |
114 |
tacattggggattttatacatttgcaagttattttctttcttc |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11307904 |
tacattggggattttatacatttgcaagttattttctttcttc |
11307862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 219
Target Start/End: Complemental strand, 11307841 - 11307801
Alignment:
| Q |
179 |
tgatttcattaagcaacaaaatcaactactatgaagtagcc |
219 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
11307841 |
tgatttcattaagcaacaaaatcaactgctatgaagcagcc |
11307801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University