View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16018_low_10 (Length: 215)
Name: NF16018_low_10
Description: NF16018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16018_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 16 - 200
Target Start/End: Original strand, 47441267 - 47441458
Alignment:
| Q |
16 |
atctacaaggtccgtctgaatgctgcaaataccatttccatattttgagcaccccagtgcatgctcaaaatggactattataatttataaacaagaaaaa |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47441267 |
atctacaaggtccgtctgaacgctgcaaataccatttccatattttgagcaccccagtgcatgctcaaaatggactattataatttataaacaagaaaaa |
47441366 |
T |
|
| Q |
116 |
aca-------tgccacagaacggacgttcaactactaaacaccaccatgctattcctttaaatcttcaaaattgacgacacagcttgtaagt |
200 |
Q |
| |
|
||| ||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47441367 |
acatgccacttgccacagaacggacattcaactactaaacaccaccatgccattcctttaaatcttcaaaattgacgacacagcttgtaagt |
47441458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University