View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16018_low_7 (Length: 270)
Name: NF16018_low_7
Description: NF16018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16018_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 249
Target Start/End: Original strand, 14812631 - 14812862
Alignment:
| Q |
18 |
gacggaaaagacgcttttgtgtttttgaatccgtcgaaggtagagaaaacgagttccagcgccggcgagacgaagaatgatgttgtaaagaaagtgaaaa |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14812631 |
gacggaaaagacgctttcgtgtttttgaatccgtcgaaggtagagaaaacgagttccagcgccggcgagacgaagaatgatgttgtaaagaaagtgaaaa |
14812730 |
T |
 |
| Q |
118 |
tggtgaaagggaaaaaggcggccccagcgccgtcggcacatgagaagcattatgtgatgagtaaagctaggaaggagaatgataaacggaaatcttattt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14812731 |
tggtgaaagggaaaaaggcggccccagcgccgtcggcacatgagaagcattatgtgatgagtaaagcgaggaaggagaatgataaacggaaatcttattt |
14812830 |
T |
 |
| Q |
218 |
gccgtataggcaagagttgtttgggttttttg |
249 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |
|
|
| T |
14812831 |
gccgtataggcaagagttgtttgggttctttg |
14812862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University