View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16019_high_15 (Length: 237)
Name: NF16019_high_15
Description: NF16019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16019_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 39628644 - 39628561
Alignment:
| Q |
1 |
taactgatttggcagatgtttaggctctgatgaaaatgttgtatttcgaacaatgagaattctgaggcgattcatcttctcaaa |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39628644 |
taactgatttggcagatgtttaggctctgatgaaaatgttttatttcgaacaatgagaattctgaggcgattcatcttctcaaa |
39628561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 113 - 213
Target Start/End: Complemental strand, 39621045 - 39620945
Alignment:
| Q |
113 |
cttgcttgacgatatctctacccatgtcttgtattagatcatgcatatccaagcagccatgtttaactattaaaagagatctattaacaagttcttcaat |
212 |
Q |
| |
|
|||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||| |||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
39621045 |
cttgcttgacaatatctctgcccatctcttgtattagatcatgcatatccaagcagccatctttaactattaagagagatttattaacaagttcttcaat |
39620946 |
T |
 |
| Q |
213 |
a |
213 |
Q |
| |
|
| |
|
|
| T |
39620945 |
a |
39620945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 14 - 84
Target Start/End: Complemental strand, 39621387 - 39621317
Alignment:
| Q |
14 |
agatgtttaggctctgatgaaaatgttgtatttcgaacaatgagaattctgaggcgattcatcttctcaaa |
84 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
39621387 |
agatgtttaggctccgatgaaaatgttgtatttcgaacaatgagaattctgaggcaattcatctgctcaaa |
39621317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 172
Target Start/End: Complemental strand, 7828532 - 7828487
Alignment:
| Q |
127 |
tctctacccatgtcttgtattagatcatgcatatccaagcagccat |
172 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
7828532 |
tctctacccatatcttgtattagatcatgcatctccaagcagccat |
7828487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 158
Target Start/End: Original strand, 7754321 - 7754352
Alignment:
| Q |
127 |
tctctacccatgtcttgtattagatcatgcat |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7754321 |
tctctacccatgtcttgtattagatcatgcat |
7754352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 158
Target Start/End: Original strand, 7837837 - 7837868
Alignment:
| Q |
127 |
tctctacccatgtcttgtattagatcatgcat |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7837837 |
tctctacccatgtcttgtattagatcatgcat |
7837868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University