View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16019_low_16 (Length: 277)
Name: NF16019_low_16
Description: NF16019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16019_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 18 - 123
Target Start/End: Complemental strand, 24819823 - 24819717
Alignment:
| Q |
18 |
atctatttgtagaaacaaagcatgaatccaacaacatacattttgtct-nnnnnnnnnnnnncaattgatgaacaatttaatactaatttgatctaacaa |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24819823 |
atctatttgcagaaacaaagcatgaatccaacaacatacattttgtctaaaaaaattaaaaacaattgatgaacaatttaatactaatttgatcaaacaa |
24819724 |
T |
 |
| Q |
117 |
atatttg |
123 |
Q |
| |
|
||||||| |
|
|
| T |
24819723 |
atatttg |
24819717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 125 - 256
Target Start/End: Original strand, 10425352 - 10425483
Alignment:
| Q |
125 |
tctcacgggcgttcttctcttcggtgacgcgatctcaagacggctaggcaggacagtttcaattatgggtcgggaatgaataggagtcttaattagaagg |
224 |
Q |
| |
|
||||| ||| ||||| |||||| ||||| |||| ||||||||||| |||| ||| ||||||| ||||| || ||| ||| ||||||||||||||| |
|
|
| T |
10425352 |
tctcatgggtgttctcctcttcagtgacacgatttcaagacggcttggcatgacgatttcaatcctgggtaatgagtgagtagaagtcttaattagaagc |
10425451 |
T |
 |
| Q |
225 |
gggttatactatgtttctatgtcagaagatat |
256 |
Q |
| |
|
|| ||||| | ||||||||||| |||||||| |
|
|
| T |
10425452 |
ggattatattgtgtttctatgtgggaagatat |
10425483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University